Review



hiscript iii  (Vazyme Biotech Co)


Bioz Verified Symbol Vazyme Biotech Co is a verified supplier
Bioz Manufacturer Symbol Vazyme Biotech Co manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Vazyme Biotech Co hiscript iii
    Hiscript Iii, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 5312 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/assays+hiscript+iii+1st+strand+cdna+synthesis+kit/HiScript+III+1st+Strand+cDNA+Synthesis+Kit+%2BgDNA+wiper/pmc13050104-105-7-9
    Average 99 stars, based on 5312 article reviews
    hiscript iii - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Article Title: Recapitulating early human development with 8C-like cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 2-D08 Selleckchem Cat#S8696 A366 Tocris Cat#5163 A83-01 Tocris Cat#2939 Ac-DEVD-CHO Selleckchem Cat#S7901 AG14361 Selleckchem Cat#S2178 A419259 Tocris Cat#3914 AM580 Tocris Cat#0760 AMG548 Tocris Cat#3920 AMI-5 Millipore Cat#539211 AS8351 Tocris Cat#6044 AZD2461 Tocris Cat#6060 BIX01294 Tocris Cat#3364 CGP77675 Cayman Chemical Cat#21089 Chaetocin Tocris Cat#4504 CHIR99021 Selleckchem Cat#S1263 CP-673451 Selleckchem Cat#S1536 Crenolanib Selleckchem Cat#S2730 CTPB Cayman Chemical Cat#19570 DBZ Tocris Cat#4489 Decitabine Selleckchem Cat#S1200 Dimethindene Tocris Cat#1425 Dorsomorphin Sigma Cat#P5499 DZNep Cayman Chemical Cat#13828 EPZ015666 Tocris Cat#6516 EZM2302 ProbeChem Cat#PC-61030 Forskolin Tocris Cat#1099 GDC0994 Selleckchem Cat#S7554 Ginkgolic acid Tocris Cat#6326 Go6983 Tocris Cat#2285 GSK1120212 Selleckchem Cat#S2673 GSK872 Tocris Cat#6492 GSK-LSD1 dihydrochloride Tocris Cat#5361 HBX41108 Tocris Cat#4285 IM-12 Enzo Life Sciences Cat#BML-WN102-0005 JIB04 Tocris Cat#4972 K02288 Tocris Cat#4986 Ki16425 Selleckchem Cat#S1315 LL507 Tocris Cat#5365 LY2874455 Selleckchem Cat#S7057 MM-102 Tocris Cat#5307 Minocycline, Hydrochloride Santa Cruz Cat#sc-203339 Sodium butyrate (NaB) Sigma Cat#B5887 Nicolsamide Tocris Cat#4079 MS049 oxalate salt Tocris Cat#5685 NSC636819 Tocris Cat#5287 OSI-744 Selleckchem Cat#S1023 PD0325901 Selleckchem Cat#S1036 PFI-2 HCl Selleckchem Cat#S7294 (Continued on next page) e2 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pladienolide B Tocris Cat#6070 Ponatinib Selleckchem Cat#S1490 PRT4165 Tocris Cat#5047 RG-108 Selleckchem Cat#S2821 SANT-1 Tocris Cat#1974 SB431542 Selleckchem Cat#S1067 SB590885 Tocris Cat#2650 SGC0946 Cayman Chemical Cat#13967 SGC2085 Selleckchem Cat#S8340 SGC707 Tocris Cat#5367 TCS-JNK-6o Tocris Cat#3222 Torin-1 Tocris Cat#4247 Tranylcypromine Enzo Life Sciences Cat#BML-EI217 TSA Selleckchem Cat#S1045 TTNPB Tocris Cat#0761 UNC1215 Selleckchem Cat#S7088 Verteporfin Tocris Cat#5305 Valproic acid (VPA) Selleckchem Cat#S3944 WH-4-023 Selleckchem Cat#S7565 XAV939 Tocris Cat#3748 Y-27632 2HCl Selleckchem Cat#S1049 DynabeadsTM Protein A Thermo Fisher Scientific Cat#10001D Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme CatR312 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat#Q711-02 NeonTM Transfection System 100 mL Kit Thermo Fisher Scientific MPK10096 VAHTS mRNA-seq V3 Library Prep Kit for Illumina Vazyme Cat#NR611 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD503 Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics Cat#1000268 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat#1000120 Deposited data prEpiSC: bulk RNA-seq and scRNA-seq This study GSE204801 8C::mCherry+ cell: RNA-seq This study GSE204801 8C::mCherry cell: RNA-seq This study GSE204801 ci8CLC: RNA-seq This study GSE204801 prEpiSC: ATAC-seq This study GSE204801 prEpiSC: H3K4me3 ChIP-seq This study GSE204801 Experimental models: Cell lines hESC (the H9 line) WiCell N/A prEpiSC This study N/A 8C::mCherry prEpiSC This study N/A ci8CLC This study N/A Oligonucleotides Primers for RT-qPCR See Table S2 N/A Recombinant DNA (Continued on next page) Cell Reports 39, 110994, June 21, 2022 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER pT2-LEUTX-mCherry (8C::mCherry) This study N/A pCW57.1-DUX4-WT (Jagannathan et al., 2016) Addgene#99282; RRID: Addgene_99,282 PB-TetON-MiniCMV-DUX4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-LEUTX-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-MBD3L2-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ZSCAN4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-UBTFL1-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KDM4E-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KLF17-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ARGFX-PGK-puro-T2A-rtTA This study N/A pT2-EF1a-FLAG-Biotin-KHDC3L-PGK-puro This study N/A pT2-EF1a-FLAG-Biotin-FAM46B-PGK-puro This study N/A SB100X (Mates et al., 2009) Izsvák lab Software and algorithms FastQC (v0.11.9) http://www.bioinformatics. babraham.ac.uk/projects https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC (v1.9) (Ewels et al., 2016) https://multiqc.info/ TrimGalore (v0.6.5) http://www.bioinformatics. babraham.ac.uk/projects http://www.bioinformatics. babraham.ac.uk/projects/ trim_galore/ STAR (v2.7.4a) (Dobin et al., 2013) https://github.com/alexdobin/ STAR featureCounts (v2.0.0) (Liao et al., 2014) http://subread.sourceforge.net/ TEtranscripts (v2.2.1) (Jin et al., 2015) https://github.com/mhammell- laboratory/TEtranscripts Seurat (v4.0.5) (Hao et al., 2021) https://satijalab.org/seurat/ DESeq2 (v1.28.1) (Love et al., 2014) https://bioconductor.org/ packages/release/bioc/html/ DESeq2.html edgeR (v3.34.1) (Robinson et al., 2010) https://bioconductor.org/ packages/release/bioc/html/ edgeR.html Scater (v1.20.1) (McCarthy et al., 2017) https://bioconductor.org/ packages/release/bioc/ html/scater.html clusterProfiler (v3.16.1) (Yu et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ clusterProfiler.html ComplexHeatmap (v2.7.4) (Gu et al., 2016) https://github.com/jokergoo/ ComplexHeatmap FactoMineR (v2.4) N/A http://factominer.free.fr Sambamba (v0.8.2) (Tarasov et al., 2015) https://lomereiter.github.io/ sambamba/index.html bowtie2 (v2.4.5) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge. net/bowtie2/index.shtml deepTools (v3.5.1) (Ramirez et al., 2016) https://deeptools.readthe docs.io/en/develop/ sva (v3.40.0) (Leek et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ sva.html (Continued on next page) e4 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS

    cDNA Synthesis:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences. .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.

    Article Title: Recapitulating early human development with 8C-like cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 2-D08 Selleckchem Cat#S8696 A366 Tocris Cat#5163 A83-01 Tocris Cat#2939 Ac-DEVD-CHO Selleckchem Cat#S7901 AG14361 Selleckchem Cat#S2178 A419259 Tocris Cat#3914 AM580 Tocris Cat#0760 AMG548 Tocris Cat#3920 AMI-5 Millipore Cat#539211 AS8351 Tocris Cat#6044 AZD2461 Tocris Cat#6060 BIX01294 Tocris Cat#3364 CGP77675 Cayman Chemical Cat#21089 Chaetocin Tocris Cat#4504 CHIR99021 Selleckchem Cat#S1263 CP-673451 Selleckchem Cat#S1536 Crenolanib Selleckchem Cat#S2730 CTPB Cayman Chemical Cat#19570 DBZ Tocris Cat#4489 Decitabine Selleckchem Cat#S1200 Dimethindene Tocris Cat#1425 Dorsomorphin Sigma Cat#P5499 DZNep Cayman Chemical Cat#13828 EPZ015666 Tocris Cat#6516 EZM2302 ProbeChem Cat#PC-61030 Forskolin Tocris Cat#1099 GDC0994 Selleckchem Cat#S7554 Ginkgolic acid Tocris Cat#6326 Go6983 Tocris Cat#2285 GSK1120212 Selleckchem Cat#S2673 GSK872 Tocris Cat#6492 GSK-LSD1 dihydrochloride Tocris Cat#5361 HBX41108 Tocris Cat#4285 IM-12 Enzo Life Sciences Cat#BML-WN102-0005 JIB04 Tocris Cat#4972 K02288 Tocris Cat#4986 Ki16425 Selleckchem Cat#S1315 LL507 Tocris Cat#5365 LY2874455 Selleckchem Cat#S7057 MM-102 Tocris Cat#5307 Minocycline, Hydrochloride Santa Cruz Cat#sc-203339 Sodium butyrate (NaB) Sigma Cat#B5887 Nicolsamide Tocris Cat#4079 MS049 oxalate salt Tocris Cat#5685 NSC636819 Tocris Cat#5287 OSI-744 Selleckchem Cat#S1023 PD0325901 Selleckchem Cat#S1036 PFI-2 HCl Selleckchem Cat#S7294 (Continued on next page) e2 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pladienolide B Tocris Cat#6070 Ponatinib Selleckchem Cat#S1490 PRT4165 Tocris Cat#5047 RG-108 Selleckchem Cat#S2821 SANT-1 Tocris Cat#1974 SB431542 Selleckchem Cat#S1067 SB590885 Tocris Cat#2650 SGC0946 Cayman Chemical Cat#13967 SGC2085 Selleckchem Cat#S8340 SGC707 Tocris Cat#5367 TCS-JNK-6o Tocris Cat#3222 Torin-1 Tocris Cat#4247 Tranylcypromine Enzo Life Sciences Cat#BML-EI217 TSA Selleckchem Cat#S1045 TTNPB Tocris Cat#0761 UNC1215 Selleckchem Cat#S7088 Verteporfin Tocris Cat#5305 Valproic acid (VPA) Selleckchem Cat#S3944 WH-4-023 Selleckchem Cat#S7565 XAV939 Tocris Cat#3748 Y-27632 2HCl Selleckchem Cat#S1049 DynabeadsTM Protein A Thermo Fisher Scientific Cat#10001D Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme CatR312 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat#Q711-02 NeonTM Transfection System 100 mL Kit Thermo Fisher Scientific MPK10096 VAHTS mRNA-seq V3 Library Prep Kit for Illumina Vazyme Cat#NR611 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD503 Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics Cat#1000268 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat#1000120 Deposited data prEpiSC: bulk RNA-seq and scRNA-seq This study GSE204801 8C::mCherry+ cell: RNA-seq This study GSE204801 8C::mCherry cell: RNA-seq This study GSE204801 ci8CLC: RNA-seq This study GSE204801 prEpiSC: ATAC-seq This study GSE204801 prEpiSC: H3K4me3 ChIP-seq This study GSE204801 Experimental models: Cell lines hESC (the H9 line) WiCell N/A prEpiSC This study N/A 8C::mCherry prEpiSC This study N/A ci8CLC This study N/A Oligonucleotides Primers for RT-qPCR See Table S2 N/A Recombinant DNA (Continued on next page) Cell Reports 39, 110994, June 21, 2022 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER pT2-LEUTX-mCherry (8C::mCherry) This study N/A pCW57.1-DUX4-WT (Jagannathan et al., 2016) Addgene#99282; RRID: Addgene_99,282 PB-TetON-MiniCMV-DUX4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-LEUTX-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-MBD3L2-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ZSCAN4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-UBTFL1-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KDM4E-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KLF17-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ARGFX-PGK-puro-T2A-rtTA This study N/A pT2-EF1a-FLAG-Biotin-KHDC3L-PGK-puro This study N/A pT2-EF1a-FLAG-Biotin-FAM46B-PGK-puro This study N/A SB100X (Mates et al., 2009) Izsvák lab Software and algorithms FastQC (v0.11.9) http://www.bioinformatics. babraham.ac.uk/projects https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC (v1.9) (Ewels et al., 2016) https://multiqc.info/ TrimGalore (v0.6.5) http://www.bioinformatics. babraham.ac.uk/projects http://www.bioinformatics. babraham.ac.uk/projects/ trim_galore/ STAR (v2.7.4a) (Dobin et al., 2013) https://github.com/alexdobin/ STAR featureCounts (v2.0.0) (Liao et al., 2014) http://subread.sourceforge.net/ TEtranscripts (v2.2.1) (Jin et al., 2015) https://github.com/mhammell- laboratory/TEtranscripts Seurat (v4.0.5) (Hao et al., 2021) https://satijalab.org/seurat/ DESeq2 (v1.28.1) (Love et al., 2014) https://bioconductor.org/ packages/release/bioc/html/ DESeq2.html edgeR (v3.34.1) (Robinson et al., 2010) https://bioconductor.org/ packages/release/bioc/html/ edgeR.html Scater (v1.20.1) (McCarthy et al., 2017) https://bioconductor.org/ packages/release/bioc/ html/scater.html clusterProfiler (v3.16.1) (Yu et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ clusterProfiler.html ComplexHeatmap (v2.7.4) (Gu et al., 2016) https://github.com/jokergoo/ ComplexHeatmap FactoMineR (v2.4) N/A http://factominer.free.fr Sambamba (v0.8.2) (Tarasov et al., 2015) https://lomereiter.github.io/ sambamba/index.html bowtie2 (v2.4.5) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge. net/bowtie2/index.shtml deepTools (v3.5.1) (Ramirez et al., 2016) https://deeptools.readthe docs.io/en/develop/ sva (v3.40.0) (Leek et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ sva.html (Continued on next page) e4 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS

    Cloning:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences. .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.

    Polymerase Chain Reaction:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    DNA Extraction:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences. .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.

    Plasmid Preparation:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences. .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.

    Membrane:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Labeling:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Sequencing:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Recombinant:

    Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025 ..

    Article Title: Recapitulating early human development with 8C-like cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 2-D08 Selleckchem Cat#S8696 A366 Tocris Cat#5163 A83-01 Tocris Cat#2939 Ac-DEVD-CHO Selleckchem Cat#S7901 AG14361 Selleckchem Cat#S2178 A419259 Tocris Cat#3914 AM580 Tocris Cat#0760 AMG548 Tocris Cat#3920 AMI-5 Millipore Cat#539211 AS8351 Tocris Cat#6044 AZD2461 Tocris Cat#6060 BIX01294 Tocris Cat#3364 CGP77675 Cayman Chemical Cat#21089 Chaetocin Tocris Cat#4504 CHIR99021 Selleckchem Cat#S1263 CP-673451 Selleckchem Cat#S1536 Crenolanib Selleckchem Cat#S2730 CTPB Cayman Chemical Cat#19570 DBZ Tocris Cat#4489 Decitabine Selleckchem Cat#S1200 Dimethindene Tocris Cat#1425 Dorsomorphin Sigma Cat#P5499 DZNep Cayman Chemical Cat#13828 EPZ015666 Tocris Cat#6516 EZM2302 ProbeChem Cat#PC-61030 Forskolin Tocris Cat#1099 GDC0994 Selleckchem Cat#S7554 Ginkgolic acid Tocris Cat#6326 Go6983 Tocris Cat#2285 GSK1120212 Selleckchem Cat#S2673 GSK872 Tocris Cat#6492 GSK-LSD1 dihydrochloride Tocris Cat#5361 HBX41108 Tocris Cat#4285 IM-12 Enzo Life Sciences Cat#BML-WN102-0005 JIB04 Tocris Cat#4972 K02288 Tocris Cat#4986 Ki16425 Selleckchem Cat#S1315 LL507 Tocris Cat#5365 LY2874455 Selleckchem Cat#S7057 MM-102 Tocris Cat#5307 Minocycline, Hydrochloride Santa Cruz Cat#sc-203339 Sodium butyrate (NaB) Sigma Cat#B5887 Nicolsamide Tocris Cat#4079 MS049 oxalate salt Tocris Cat#5685 NSC636819 Tocris Cat#5287 OSI-744 Selleckchem Cat#S1023 PD0325901 Selleckchem Cat#S1036 PFI-2 HCl Selleckchem Cat#S7294 (Continued on next page) e2 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pladienolide B Tocris Cat#6070 Ponatinib Selleckchem Cat#S1490 PRT4165 Tocris Cat#5047 RG-108 Selleckchem Cat#S2821 SANT-1 Tocris Cat#1974 SB431542 Selleckchem Cat#S1067 SB590885 Tocris Cat#2650 SGC0946 Cayman Chemical Cat#13967 SGC2085 Selleckchem Cat#S8340 SGC707 Tocris Cat#5367 TCS-JNK-6o Tocris Cat#3222 Torin-1 Tocris Cat#4247 Tranylcypromine Enzo Life Sciences Cat#BML-EI217 TSA Selleckchem Cat#S1045 TTNPB Tocris Cat#0761 UNC1215 Selleckchem Cat#S7088 Verteporfin Tocris Cat#5305 Valproic acid (VPA) Selleckchem Cat#S3944 WH-4-023 Selleckchem Cat#S7565 XAV939 Tocris Cat#3748 Y-27632 2HCl Selleckchem Cat#S1049 DynabeadsTM Protein A Thermo Fisher Scientific Cat#10001D Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme CatR312 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat#Q711-02 NeonTM Transfection System 100 mL Kit Thermo Fisher Scientific MPK10096 VAHTS mRNA-seq V3 Library Prep Kit for Illumina Vazyme Cat#NR611 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD503 Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics Cat#1000268 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat#1000120 Deposited data prEpiSC: bulk RNA-seq and scRNA-seq This study GSE204801 8C::mCherry+ cell: RNA-seq This study GSE204801 8C::mCherry cell: RNA-seq This study GSE204801 ci8CLC: RNA-seq This study GSE204801 prEpiSC: ATAC-seq This study GSE204801 prEpiSC: H3K4me3 ChIP-seq This study GSE204801 Experimental models: Cell lines hESC (the H9 line) WiCell N/A prEpiSC This study N/A 8C::mCherry prEpiSC This study N/A ci8CLC This study N/A Oligonucleotides Primers for RT-qPCR See Table S2 N/A Recombinant DNA (Continued on next page) Cell Reports 39, 110994, June 21, 2022 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER pT2-LEUTX-mCherry (8C::mCherry) This study N/A pCW57.1-DUX4-WT (Jagannathan et al., 2016) Addgene#99282; RRID: Addgene_99,282 PB-TetON-MiniCMV-DUX4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-LEUTX-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-MBD3L2-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ZSCAN4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-UBTFL1-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KDM4E-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KLF17-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ARGFX-PGK-puro-T2A-rtTA This study N/A pT2-EF1a-FLAG-Biotin-KHDC3L-PGK-puro This study N/A pT2-EF1a-FLAG-Biotin-FAM46B-PGK-puro This study N/A SB100X (Mates et al., 2009) Izsvák lab Software and algorithms FastQC (v0.11.9) http://www.bioinformatics. babraham.ac.uk/projects https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC (v1.9) (Ewels et al., 2016) https://multiqc.info/ TrimGalore (v0.6.5) http://www.bioinformatics. babraham.ac.uk/projects http://www.bioinformatics. babraham.ac.uk/projects/ trim_galore/ STAR (v2.7.4a) (Dobin et al., 2013) https://github.com/alexdobin/ STAR featureCounts (v2.0.0) (Liao et al., 2014) http://subread.sourceforge.net/ TEtranscripts (v2.2.1) (Jin et al., 2015) https://github.com/mhammell- laboratory/TEtranscripts Seurat (v4.0.5) (Hao et al., 2021) https://satijalab.org/seurat/ DESeq2 (v1.28.1) (Love et al., 2014) https://bioconductor.org/ packages/release/bioc/html/ DESeq2.html edgeR (v3.34.1) (Robinson et al., 2010) https://bioconductor.org/ packages/release/bioc/html/ edgeR.html Scater (v1.20.1) (McCarthy et al., 2017) https://bioconductor.org/ packages/release/bioc/ html/scater.html clusterProfiler (v3.16.1) (Yu et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ clusterProfiler.html ComplexHeatmap (v2.7.4) (Gu et al., 2016) https://github.com/jokergoo/ ComplexHeatmap FactoMineR (v2.4) N/A http://factominer.free.fr Sambamba (v0.8.2) (Tarasov et al., 2015) https://lomereiter.github.io/ sambamba/index.html bowtie2 (v2.4.5) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge. net/bowtie2/index.shtml deepTools (v3.5.1) (Ramirez et al., 2016) https://deeptools.readthe docs.io/en/develop/ sva (v3.40.0) (Leek et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ sva.html (Continued on next page) e4 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS

    Transfection:

    Article Title: Recapitulating early human development with 8C-like cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 2-D08 Selleckchem Cat#S8696 A366 Tocris Cat#5163 A83-01 Tocris Cat#2939 Ac-DEVD-CHO Selleckchem Cat#S7901 AG14361 Selleckchem Cat#S2178 A419259 Tocris Cat#3914 AM580 Tocris Cat#0760 AMG548 Tocris Cat#3920 AMI-5 Millipore Cat#539211 AS8351 Tocris Cat#6044 AZD2461 Tocris Cat#6060 BIX01294 Tocris Cat#3364 CGP77675 Cayman Chemical Cat#21089 Chaetocin Tocris Cat#4504 CHIR99021 Selleckchem Cat#S1263 CP-673451 Selleckchem Cat#S1536 Crenolanib Selleckchem Cat#S2730 CTPB Cayman Chemical Cat#19570 DBZ Tocris Cat#4489 Decitabine Selleckchem Cat#S1200 Dimethindene Tocris Cat#1425 Dorsomorphin Sigma Cat#P5499 DZNep Cayman Chemical Cat#13828 EPZ015666 Tocris Cat#6516 EZM2302 ProbeChem Cat#PC-61030 Forskolin Tocris Cat#1099 GDC0994 Selleckchem Cat#S7554 Ginkgolic acid Tocris Cat#6326 Go6983 Tocris Cat#2285 GSK1120212 Selleckchem Cat#S2673 GSK872 Tocris Cat#6492 GSK-LSD1 dihydrochloride Tocris Cat#5361 HBX41108 Tocris Cat#4285 IM-12 Enzo Life Sciences Cat#BML-WN102-0005 JIB04 Tocris Cat#4972 K02288 Tocris Cat#4986 Ki16425 Selleckchem Cat#S1315 LL507 Tocris Cat#5365 LY2874455 Selleckchem Cat#S7057 MM-102 Tocris Cat#5307 Minocycline, Hydrochloride Santa Cruz Cat#sc-203339 Sodium butyrate (NaB) Sigma Cat#B5887 Nicolsamide Tocris Cat#4079 MS049 oxalate salt Tocris Cat#5685 NSC636819 Tocris Cat#5287 OSI-744 Selleckchem Cat#S1023 PD0325901 Selleckchem Cat#S1036 PFI-2 HCl Selleckchem Cat#S7294 (Continued on next page) e2 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pladienolide B Tocris Cat#6070 Ponatinib Selleckchem Cat#S1490 PRT4165 Tocris Cat#5047 RG-108 Selleckchem Cat#S2821 SANT-1 Tocris Cat#1974 SB431542 Selleckchem Cat#S1067 SB590885 Tocris Cat#2650 SGC0946 Cayman Chemical Cat#13967 SGC2085 Selleckchem Cat#S8340 SGC707 Tocris Cat#5367 TCS-JNK-6o Tocris Cat#3222 Torin-1 Tocris Cat#4247 Tranylcypromine Enzo Life Sciences Cat#BML-EI217 TSA Selleckchem Cat#S1045 TTNPB Tocris Cat#0761 UNC1215 Selleckchem Cat#S7088 Verteporfin Tocris Cat#5305 Valproic acid (VPA) Selleckchem Cat#S3944 WH-4-023 Selleckchem Cat#S7565 XAV939 Tocris Cat#3748 Y-27632 2HCl Selleckchem Cat#S1049 DynabeadsTM Protein A Thermo Fisher Scientific Cat#10001D Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme CatR312 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat#Q711-02 NeonTM Transfection System 100 mL Kit Thermo Fisher Scientific MPK10096 VAHTS mRNA-seq V3 Library Prep Kit for Illumina Vazyme Cat#NR611 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD503 Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics Cat#1000268 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat#1000120 Deposited data prEpiSC: bulk RNA-seq and scRNA-seq This study GSE204801 8C::mCherry+ cell: RNA-seq This study GSE204801 8C::mCherry cell: RNA-seq This study GSE204801 ci8CLC: RNA-seq This study GSE204801 prEpiSC: ATAC-seq This study GSE204801 prEpiSC: H3K4me3 ChIP-seq This study GSE204801 Experimental models: Cell lines hESC (the H9 line) WiCell N/A prEpiSC This study N/A 8C::mCherry prEpiSC This study N/A ci8CLC This study N/A Oligonucleotides Primers for RT-qPCR See Table S2 N/A Recombinant DNA (Continued on next page) Cell Reports 39, 110994, June 21, 2022 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER pT2-LEUTX-mCherry (8C::mCherry) This study N/A pCW57.1-DUX4-WT (Jagannathan et al., 2016) Addgene#99282; RRID: Addgene_99,282 PB-TetON-MiniCMV-DUX4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-LEUTX-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-MBD3L2-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ZSCAN4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-UBTFL1-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KDM4E-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KLF17-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ARGFX-PGK-puro-T2A-rtTA This study N/A pT2-EF1a-FLAG-Biotin-KHDC3L-PGK-puro This study N/A pT2-EF1a-FLAG-Biotin-FAM46B-PGK-puro This study N/A SB100X (Mates et al., 2009) Izsvák lab Software and algorithms FastQC (v0.11.9) http://www.bioinformatics. babraham.ac.uk/projects https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC (v1.9) (Ewels et al., 2016) https://multiqc.info/ TrimGalore (v0.6.5) http://www.bioinformatics. babraham.ac.uk/projects http://www.bioinformatics. babraham.ac.uk/projects/ trim_galore/ STAR (v2.7.4a) (Dobin et al., 2013) https://github.com/alexdobin/ STAR featureCounts (v2.0.0) (Liao et al., 2014) http://subread.sourceforge.net/ TEtranscripts (v2.2.1) (Jin et al., 2015) https://github.com/mhammell- laboratory/TEtranscripts Seurat (v4.0.5) (Hao et al., 2021) https://satijalab.org/seurat/ DESeq2 (v1.28.1) (Love et al., 2014) https://bioconductor.org/ packages/release/bioc/html/ DESeq2.html edgeR (v3.34.1) (Robinson et al., 2010) https://bioconductor.org/ packages/release/bioc/html/ edgeR.html Scater (v1.20.1) (McCarthy et al., 2017) https://bioconductor.org/ packages/release/bioc/ html/scater.html clusterProfiler (v3.16.1) (Yu et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ clusterProfiler.html ComplexHeatmap (v2.7.4) (Gu et al., 2016) https://github.com/jokergoo/ ComplexHeatmap FactoMineR (v2.4) N/A http://factominer.free.fr Sambamba (v0.8.2) (Tarasov et al., 2015) https://lomereiter.github.io/ sambamba/index.html bowtie2 (v2.4.5) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge. net/bowtie2/index.shtml deepTools (v3.5.1) (Ramirez et al., 2016) https://deeptools.readthe docs.io/en/develop/ sva (v3.40.0) (Leek et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ sva.html (Continued on next page) e4 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS

    Single Cell:

    Article Title: Recapitulating early human development with 8C-like cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 2-D08 Selleckchem Cat#S8696 A366 Tocris Cat#5163 A83-01 Tocris Cat#2939 Ac-DEVD-CHO Selleckchem Cat#S7901 AG14361 Selleckchem Cat#S2178 A419259 Tocris Cat#3914 AM580 Tocris Cat#0760 AMG548 Tocris Cat#3920 AMI-5 Millipore Cat#539211 AS8351 Tocris Cat#6044 AZD2461 Tocris Cat#6060 BIX01294 Tocris Cat#3364 CGP77675 Cayman Chemical Cat#21089 Chaetocin Tocris Cat#4504 CHIR99021 Selleckchem Cat#S1263 CP-673451 Selleckchem Cat#S1536 Crenolanib Selleckchem Cat#S2730 CTPB Cayman Chemical Cat#19570 DBZ Tocris Cat#4489 Decitabine Selleckchem Cat#S1200 Dimethindene Tocris Cat#1425 Dorsomorphin Sigma Cat#P5499 DZNep Cayman Chemical Cat#13828 EPZ015666 Tocris Cat#6516 EZM2302 ProbeChem Cat#PC-61030 Forskolin Tocris Cat#1099 GDC0994 Selleckchem Cat#S7554 Ginkgolic acid Tocris Cat#6326 Go6983 Tocris Cat#2285 GSK1120212 Selleckchem Cat#S2673 GSK872 Tocris Cat#6492 GSK-LSD1 dihydrochloride Tocris Cat#5361 HBX41108 Tocris Cat#4285 IM-12 Enzo Life Sciences Cat#BML-WN102-0005 JIB04 Tocris Cat#4972 K02288 Tocris Cat#4986 Ki16425 Selleckchem Cat#S1315 LL507 Tocris Cat#5365 LY2874455 Selleckchem Cat#S7057 MM-102 Tocris Cat#5307 Minocycline, Hydrochloride Santa Cruz Cat#sc-203339 Sodium butyrate (NaB) Sigma Cat#B5887 Nicolsamide Tocris Cat#4079 MS049 oxalate salt Tocris Cat#5685 NSC636819 Tocris Cat#5287 OSI-744 Selleckchem Cat#S1023 PD0325901 Selleckchem Cat#S1036 PFI-2 HCl Selleckchem Cat#S7294 (Continued on next page) e2 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pladienolide B Tocris Cat#6070 Ponatinib Selleckchem Cat#S1490 PRT4165 Tocris Cat#5047 RG-108 Selleckchem Cat#S2821 SANT-1 Tocris Cat#1974 SB431542 Selleckchem Cat#S1067 SB590885 Tocris Cat#2650 SGC0946 Cayman Chemical Cat#13967 SGC2085 Selleckchem Cat#S8340 SGC707 Tocris Cat#5367 TCS-JNK-6o Tocris Cat#3222 Torin-1 Tocris Cat#4247 Tranylcypromine Enzo Life Sciences Cat#BML-EI217 TSA Selleckchem Cat#S1045 TTNPB Tocris Cat#0761 UNC1215 Selleckchem Cat#S7088 Verteporfin Tocris Cat#5305 Valproic acid (VPA) Selleckchem Cat#S3944 WH-4-023 Selleckchem Cat#S7565 XAV939 Tocris Cat#3748 Y-27632 2HCl Selleckchem Cat#S1049 DynabeadsTM Protein A Thermo Fisher Scientific Cat#10001D Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme CatR312 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat#Q711-02 NeonTM Transfection System 100 mL Kit Thermo Fisher Scientific MPK10096 VAHTS mRNA-seq V3 Library Prep Kit for Illumina Vazyme Cat#NR611 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD503 Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics Cat#1000268 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat#1000120 Deposited data prEpiSC: bulk RNA-seq and scRNA-seq This study GSE204801 8C::mCherry+ cell: RNA-seq This study GSE204801 8C::mCherry cell: RNA-seq This study GSE204801 ci8CLC: RNA-seq This study GSE204801 prEpiSC: ATAC-seq This study GSE204801 prEpiSC: H3K4me3 ChIP-seq This study GSE204801 Experimental models: Cell lines hESC (the H9 line) WiCell N/A prEpiSC This study N/A 8C::mCherry prEpiSC This study N/A ci8CLC This study N/A Oligonucleotides Primers for RT-qPCR See Table S2 N/A Recombinant DNA (Continued on next page) Cell Reports 39, 110994, June 21, 2022 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER pT2-LEUTX-mCherry (8C::mCherry) This study N/A pCW57.1-DUX4-WT (Jagannathan et al., 2016) Addgene#99282; RRID: Addgene_99,282 PB-TetON-MiniCMV-DUX4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-LEUTX-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-MBD3L2-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ZSCAN4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-UBTFL1-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KDM4E-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KLF17-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ARGFX-PGK-puro-T2A-rtTA This study N/A pT2-EF1a-FLAG-Biotin-KHDC3L-PGK-puro This study N/A pT2-EF1a-FLAG-Biotin-FAM46B-PGK-puro This study N/A SB100X (Mates et al., 2009) Izsvák lab Software and algorithms FastQC (v0.11.9) http://www.bioinformatics. babraham.ac.uk/projects https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC (v1.9) (Ewels et al., 2016) https://multiqc.info/ TrimGalore (v0.6.5) http://www.bioinformatics. babraham.ac.uk/projects http://www.bioinformatics. babraham.ac.uk/projects/ trim_galore/ STAR (v2.7.4a) (Dobin et al., 2013) https://github.com/alexdobin/ STAR featureCounts (v2.0.0) (Liao et al., 2014) http://subread.sourceforge.net/ TEtranscripts (v2.2.1) (Jin et al., 2015) https://github.com/mhammell- laboratory/TEtranscripts Seurat (v4.0.5) (Hao et al., 2021) https://satijalab.org/seurat/ DESeq2 (v1.28.1) (Love et al., 2014) https://bioconductor.org/ packages/release/bioc/html/ DESeq2.html edgeR (v3.34.1) (Robinson et al., 2010) https://bioconductor.org/ packages/release/bioc/html/ edgeR.html Scater (v1.20.1) (McCarthy et al., 2017) https://bioconductor.org/ packages/release/bioc/ html/scater.html clusterProfiler (v3.16.1) (Yu et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ clusterProfiler.html ComplexHeatmap (v2.7.4) (Gu et al., 2016) https://github.com/jokergoo/ ComplexHeatmap FactoMineR (v2.4) N/A http://factominer.free.fr Sambamba (v0.8.2) (Tarasov et al., 2015) https://lomereiter.github.io/ sambamba/index.html bowtie2 (v2.4.5) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge. net/bowtie2/index.shtml deepTools (v3.5.1) (Ramirez et al., 2016) https://deeptools.readthe docs.io/en/develop/ sva (v3.40.0) (Leek et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ sva.html (Continued on next page) e4 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS

    RNA Sequencing:

    Article Title: Recapitulating early human development with 8C-like cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 2-D08 Selleckchem Cat#S8696 A366 Tocris Cat#5163 A83-01 Tocris Cat#2939 Ac-DEVD-CHO Selleckchem Cat#S7901 AG14361 Selleckchem Cat#S2178 A419259 Tocris Cat#3914 AM580 Tocris Cat#0760 AMG548 Tocris Cat#3920 AMI-5 Millipore Cat#539211 AS8351 Tocris Cat#6044 AZD2461 Tocris Cat#6060 BIX01294 Tocris Cat#3364 CGP77675 Cayman Chemical Cat#21089 Chaetocin Tocris Cat#4504 CHIR99021 Selleckchem Cat#S1263 CP-673451 Selleckchem Cat#S1536 Crenolanib Selleckchem Cat#S2730 CTPB Cayman Chemical Cat#19570 DBZ Tocris Cat#4489 Decitabine Selleckchem Cat#S1200 Dimethindene Tocris Cat#1425 Dorsomorphin Sigma Cat#P5499 DZNep Cayman Chemical Cat#13828 EPZ015666 Tocris Cat#6516 EZM2302 ProbeChem Cat#PC-61030 Forskolin Tocris Cat#1099 GDC0994 Selleckchem Cat#S7554 Ginkgolic acid Tocris Cat#6326 Go6983 Tocris Cat#2285 GSK1120212 Selleckchem Cat#S2673 GSK872 Tocris Cat#6492 GSK-LSD1 dihydrochloride Tocris Cat#5361 HBX41108 Tocris Cat#4285 IM-12 Enzo Life Sciences Cat#BML-WN102-0005 JIB04 Tocris Cat#4972 K02288 Tocris Cat#4986 Ki16425 Selleckchem Cat#S1315 LL507 Tocris Cat#5365 LY2874455 Selleckchem Cat#S7057 MM-102 Tocris Cat#5307 Minocycline, Hydrochloride Santa Cruz Cat#sc-203339 Sodium butyrate (NaB) Sigma Cat#B5887 Nicolsamide Tocris Cat#4079 MS049 oxalate salt Tocris Cat#5685 NSC636819 Tocris Cat#5287 OSI-744 Selleckchem Cat#S1023 PD0325901 Selleckchem Cat#S1036 PFI-2 HCl Selleckchem Cat#S7294 (Continued on next page) e2 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pladienolide B Tocris Cat#6070 Ponatinib Selleckchem Cat#S1490 PRT4165 Tocris Cat#5047 RG-108 Selleckchem Cat#S2821 SANT-1 Tocris Cat#1974 SB431542 Selleckchem Cat#S1067 SB590885 Tocris Cat#2650 SGC0946 Cayman Chemical Cat#13967 SGC2085 Selleckchem Cat#S8340 SGC707 Tocris Cat#5367 TCS-JNK-6o Tocris Cat#3222 Torin-1 Tocris Cat#4247 Tranylcypromine Enzo Life Sciences Cat#BML-EI217 TSA Selleckchem Cat#S1045 TTNPB Tocris Cat#0761 UNC1215 Selleckchem Cat#S7088 Verteporfin Tocris Cat#5305 Valproic acid (VPA) Selleckchem Cat#S3944 WH-4-023 Selleckchem Cat#S7565 XAV939 Tocris Cat#3748 Y-27632 2HCl Selleckchem Cat#S1049 DynabeadsTM Protein A Thermo Fisher Scientific Cat#10001D Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme CatR312 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat#Q711-02 NeonTM Transfection System 100 mL Kit Thermo Fisher Scientific MPK10096 VAHTS mRNA-seq V3 Library Prep Kit for Illumina Vazyme Cat#NR611 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD503 Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics Cat#1000268 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat#1000120 Deposited data prEpiSC: bulk RNA-seq and scRNA-seq This study GSE204801 8C::mCherry+ cell: RNA-seq This study GSE204801 8C::mCherry cell: RNA-seq This study GSE204801 ci8CLC: RNA-seq This study GSE204801 prEpiSC: ATAC-seq This study GSE204801 prEpiSC: H3K4me3 ChIP-seq This study GSE204801 Experimental models: Cell lines hESC (the H9 line) WiCell N/A prEpiSC This study N/A 8C::mCherry prEpiSC This study N/A ci8CLC This study N/A Oligonucleotides Primers for RT-qPCR See Table S2 N/A Recombinant DNA (Continued on next page) Cell Reports 39, 110994, June 21, 2022 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER pT2-LEUTX-mCherry (8C::mCherry) This study N/A pCW57.1-DUX4-WT (Jagannathan et al., 2016) Addgene#99282; RRID: Addgene_99,282 PB-TetON-MiniCMV-DUX4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-LEUTX-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-MBD3L2-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ZSCAN4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-UBTFL1-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KDM4E-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KLF17-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ARGFX-PGK-puro-T2A-rtTA This study N/A pT2-EF1a-FLAG-Biotin-KHDC3L-PGK-puro This study N/A pT2-EF1a-FLAG-Biotin-FAM46B-PGK-puro This study N/A SB100X (Mates et al., 2009) Izsvák lab Software and algorithms FastQC (v0.11.9) http://www.bioinformatics. babraham.ac.uk/projects https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC (v1.9) (Ewels et al., 2016) https://multiqc.info/ TrimGalore (v0.6.5) http://www.bioinformatics. babraham.ac.uk/projects http://www.bioinformatics. babraham.ac.uk/projects/ trim_galore/ STAR (v2.7.4a) (Dobin et al., 2013) https://github.com/alexdobin/ STAR featureCounts (v2.0.0) (Liao et al., 2014) http://subread.sourceforge.net/ TEtranscripts (v2.2.1) (Jin et al., 2015) https://github.com/mhammell- laboratory/TEtranscripts Seurat (v4.0.5) (Hao et al., 2021) https://satijalab.org/seurat/ DESeq2 (v1.28.1) (Love et al., 2014) https://bioconductor.org/ packages/release/bioc/html/ DESeq2.html edgeR (v3.34.1) (Robinson et al., 2010) https://bioconductor.org/ packages/release/bioc/html/ edgeR.html Scater (v1.20.1) (McCarthy et al., 2017) https://bioconductor.org/ packages/release/bioc/ html/scater.html clusterProfiler (v3.16.1) (Yu et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ clusterProfiler.html ComplexHeatmap (v2.7.4) (Gu et al., 2016) https://github.com/jokergoo/ ComplexHeatmap FactoMineR (v2.4) N/A http://factominer.free.fr Sambamba (v0.8.2) (Tarasov et al., 2015) https://lomereiter.github.io/ sambamba/index.html bowtie2 (v2.4.5) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge. net/bowtie2/index.shtml deepTools (v3.5.1) (Ramirez et al., 2016) https://deeptools.readthe docs.io/en/develop/ sva (v3.40.0) (Leek et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ sva.html (Continued on next page) e4 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS

    Chromatin Immunoprecipitation:

    Article Title: Recapitulating early human development with 8C-like cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 2-D08 Selleckchem Cat#S8696 A366 Tocris Cat#5163 A83-01 Tocris Cat#2939 Ac-DEVD-CHO Selleckchem Cat#S7901 AG14361 Selleckchem Cat#S2178 A419259 Tocris Cat#3914 AM580 Tocris Cat#0760 AMG548 Tocris Cat#3920 AMI-5 Millipore Cat#539211 AS8351 Tocris Cat#6044 AZD2461 Tocris Cat#6060 BIX01294 Tocris Cat#3364 CGP77675 Cayman Chemical Cat#21089 Chaetocin Tocris Cat#4504 CHIR99021 Selleckchem Cat#S1263 CP-673451 Selleckchem Cat#S1536 Crenolanib Selleckchem Cat#S2730 CTPB Cayman Chemical Cat#19570 DBZ Tocris Cat#4489 Decitabine Selleckchem Cat#S1200 Dimethindene Tocris Cat#1425 Dorsomorphin Sigma Cat#P5499 DZNep Cayman Chemical Cat#13828 EPZ015666 Tocris Cat#6516 EZM2302 ProbeChem Cat#PC-61030 Forskolin Tocris Cat#1099 GDC0994 Selleckchem Cat#S7554 Ginkgolic acid Tocris Cat#6326 Go6983 Tocris Cat#2285 GSK1120212 Selleckchem Cat#S2673 GSK872 Tocris Cat#6492 GSK-LSD1 dihydrochloride Tocris Cat#5361 HBX41108 Tocris Cat#4285 IM-12 Enzo Life Sciences Cat#BML-WN102-0005 JIB04 Tocris Cat#4972 K02288 Tocris Cat#4986 Ki16425 Selleckchem Cat#S1315 LL507 Tocris Cat#5365 LY2874455 Selleckchem Cat#S7057 MM-102 Tocris Cat#5307 Minocycline, Hydrochloride Santa Cruz Cat#sc-203339 Sodium butyrate (NaB) Sigma Cat#B5887 Nicolsamide Tocris Cat#4079 MS049 oxalate salt Tocris Cat#5685 NSC636819 Tocris Cat#5287 OSI-744 Selleckchem Cat#S1023 PD0325901 Selleckchem Cat#S1036 PFI-2 HCl Selleckchem Cat#S7294 (Continued on next page) e2 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pladienolide B Tocris Cat#6070 Ponatinib Selleckchem Cat#S1490 PRT4165 Tocris Cat#5047 RG-108 Selleckchem Cat#S2821 SANT-1 Tocris Cat#1974 SB431542 Selleckchem Cat#S1067 SB590885 Tocris Cat#2650 SGC0946 Cayman Chemical Cat#13967 SGC2085 Selleckchem Cat#S8340 SGC707 Tocris Cat#5367 TCS-JNK-6o Tocris Cat#3222 Torin-1 Tocris Cat#4247 Tranylcypromine Enzo Life Sciences Cat#BML-EI217 TSA Selleckchem Cat#S1045 TTNPB Tocris Cat#0761 UNC1215 Selleckchem Cat#S7088 Verteporfin Tocris Cat#5305 Valproic acid (VPA) Selleckchem Cat#S3944 WH-4-023 Selleckchem Cat#S7565 XAV939 Tocris Cat#3748 Y-27632 2HCl Selleckchem Cat#S1049 DynabeadsTM Protein A Thermo Fisher Scientific Cat#10001D Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme CatR312 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat#Q711-02 NeonTM Transfection System 100 mL Kit Thermo Fisher Scientific MPK10096 VAHTS mRNA-seq V3 Library Prep Kit for Illumina Vazyme Cat#NR611 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD503 Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics Cat#1000268 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat#1000120 Deposited data prEpiSC: bulk RNA-seq and scRNA-seq This study GSE204801 8C::mCherry+ cell: RNA-seq This study GSE204801 8C::mCherry cell: RNA-seq This study GSE204801 ci8CLC: RNA-seq This study GSE204801 prEpiSC: ATAC-seq This study GSE204801 prEpiSC: H3K4me3 ChIP-seq This study GSE204801 Experimental models: Cell lines hESC (the H9 line) WiCell N/A prEpiSC This study N/A 8C::mCherry prEpiSC This study N/A ci8CLC This study N/A Oligonucleotides Primers for RT-qPCR See Table S2 N/A Recombinant DNA (Continued on next page) Cell Reports 39, 110994, June 21, 2022 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER pT2-LEUTX-mCherry (8C::mCherry) This study N/A pCW57.1-DUX4-WT (Jagannathan et al., 2016) Addgene#99282; RRID: Addgene_99,282 PB-TetON-MiniCMV-DUX4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-LEUTX-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-MBD3L2-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ZSCAN4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-UBTFL1-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KDM4E-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KLF17-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ARGFX-PGK-puro-T2A-rtTA This study N/A pT2-EF1a-FLAG-Biotin-KHDC3L-PGK-puro This study N/A pT2-EF1a-FLAG-Biotin-FAM46B-PGK-puro This study N/A SB100X (Mates et al., 2009) Izsvák lab Software and algorithms FastQC (v0.11.9) http://www.bioinformatics. babraham.ac.uk/projects https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC (v1.9) (Ewels et al., 2016) https://multiqc.info/ TrimGalore (v0.6.5) http://www.bioinformatics. babraham.ac.uk/projects http://www.bioinformatics. babraham.ac.uk/projects/ trim_galore/ STAR (v2.7.4a) (Dobin et al., 2013) https://github.com/alexdobin/ STAR featureCounts (v2.0.0) (Liao et al., 2014) http://subread.sourceforge.net/ TEtranscripts (v2.2.1) (Jin et al., 2015) https://github.com/mhammell- laboratory/TEtranscripts Seurat (v4.0.5) (Hao et al., 2021) https://satijalab.org/seurat/ DESeq2 (v1.28.1) (Love et al., 2014) https://bioconductor.org/ packages/release/bioc/html/ DESeq2.html edgeR (v3.34.1) (Robinson et al., 2010) https://bioconductor.org/ packages/release/bioc/html/ edgeR.html Scater (v1.20.1) (McCarthy et al., 2017) https://bioconductor.org/ packages/release/bioc/ html/scater.html clusterProfiler (v3.16.1) (Yu et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ clusterProfiler.html ComplexHeatmap (v2.7.4) (Gu et al., 2016) https://github.com/jokergoo/ ComplexHeatmap FactoMineR (v2.4) N/A http://factominer.free.fr Sambamba (v0.8.2) (Tarasov et al., 2015) https://lomereiter.github.io/ sambamba/index.html bowtie2 (v2.4.5) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge. net/bowtie2/index.shtml deepTools (v3.5.1) (Ramirez et al., 2016) https://deeptools.readthe docs.io/en/develop/ sva (v3.40.0) (Leek et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ sva.html (Continued on next page) e4 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS

    Quantitative RT-PCR:

    Article Title: Recapitulating early human development with 8C-like cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 2-D08 Selleckchem Cat#S8696 A366 Tocris Cat#5163 A83-01 Tocris Cat#2939 Ac-DEVD-CHO Selleckchem Cat#S7901 AG14361 Selleckchem Cat#S2178 A419259 Tocris Cat#3914 AM580 Tocris Cat#0760 AMG548 Tocris Cat#3920 AMI-5 Millipore Cat#539211 AS8351 Tocris Cat#6044 AZD2461 Tocris Cat#6060 BIX01294 Tocris Cat#3364 CGP77675 Cayman Chemical Cat#21089 Chaetocin Tocris Cat#4504 CHIR99021 Selleckchem Cat#S1263 CP-673451 Selleckchem Cat#S1536 Crenolanib Selleckchem Cat#S2730 CTPB Cayman Chemical Cat#19570 DBZ Tocris Cat#4489 Decitabine Selleckchem Cat#S1200 Dimethindene Tocris Cat#1425 Dorsomorphin Sigma Cat#P5499 DZNep Cayman Chemical Cat#13828 EPZ015666 Tocris Cat#6516 EZM2302 ProbeChem Cat#PC-61030 Forskolin Tocris Cat#1099 GDC0994 Selleckchem Cat#S7554 Ginkgolic acid Tocris Cat#6326 Go6983 Tocris Cat#2285 GSK1120212 Selleckchem Cat#S2673 GSK872 Tocris Cat#6492 GSK-LSD1 dihydrochloride Tocris Cat#5361 HBX41108 Tocris Cat#4285 IM-12 Enzo Life Sciences Cat#BML-WN102-0005 JIB04 Tocris Cat#4972 K02288 Tocris Cat#4986 Ki16425 Selleckchem Cat#S1315 LL507 Tocris Cat#5365 LY2874455 Selleckchem Cat#S7057 MM-102 Tocris Cat#5307 Minocycline, Hydrochloride Santa Cruz Cat#sc-203339 Sodium butyrate (NaB) Sigma Cat#B5887 Nicolsamide Tocris Cat#4079 MS049 oxalate salt Tocris Cat#5685 NSC636819 Tocris Cat#5287 OSI-744 Selleckchem Cat#S1023 PD0325901 Selleckchem Cat#S1036 PFI-2 HCl Selleckchem Cat#S7294 (Continued on next page) e2 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pladienolide B Tocris Cat#6070 Ponatinib Selleckchem Cat#S1490 PRT4165 Tocris Cat#5047 RG-108 Selleckchem Cat#S2821 SANT-1 Tocris Cat#1974 SB431542 Selleckchem Cat#S1067 SB590885 Tocris Cat#2650 SGC0946 Cayman Chemical Cat#13967 SGC2085 Selleckchem Cat#S8340 SGC707 Tocris Cat#5367 TCS-JNK-6o Tocris Cat#3222 Torin-1 Tocris Cat#4247 Tranylcypromine Enzo Life Sciences Cat#BML-EI217 TSA Selleckchem Cat#S1045 TTNPB Tocris Cat#0761 UNC1215 Selleckchem Cat#S7088 Verteporfin Tocris Cat#5305 Valproic acid (VPA) Selleckchem Cat#S3944 WH-4-023 Selleckchem Cat#S7565 XAV939 Tocris Cat#3748 Y-27632 2HCl Selleckchem Cat#S1049 DynabeadsTM Protein A Thermo Fisher Scientific Cat#10001D Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme CatR312 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323-01 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat#Q711-02 NeonTM Transfection System 100 mL Kit Thermo Fisher Scientific MPK10096 VAHTS mRNA-seq V3 Library Prep Kit for Illumina Vazyme Cat#NR611 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD503 Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics Cat#1000268 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat#1000120 Deposited data prEpiSC: bulk RNA-seq and scRNA-seq This study GSE204801 8C::mCherry+ cell: RNA-seq This study GSE204801 8C::mCherry cell: RNA-seq This study GSE204801 ci8CLC: RNA-seq This study GSE204801 prEpiSC: ATAC-seq This study GSE204801 prEpiSC: H3K4me3 ChIP-seq This study GSE204801 Experimental models: Cell lines hESC (the H9 line) WiCell N/A prEpiSC This study N/A 8C::mCherry prEpiSC This study N/A ci8CLC This study N/A Oligonucleotides Primers for RT-qPCR See Table S2 N/A Recombinant DNA (Continued on next page) Cell Reports 39, 110994, June 21, 2022 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER pT2-LEUTX-mCherry (8C::mCherry) This study N/A pCW57.1-DUX4-WT (Jagannathan et al., 2016) Addgene#99282; RRID: Addgene_99,282 PB-TetON-MiniCMV-DUX4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-LEUTX-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-MBD3L2-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ZSCAN4-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-UBTFL1-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KDM4E-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-KLF17-PGK-puro-T2A-rtTA This study N/A PB-TetON-MiniCMV-ARGFX-PGK-puro-T2A-rtTA This study N/A pT2-EF1a-FLAG-Biotin-KHDC3L-PGK-puro This study N/A pT2-EF1a-FLAG-Biotin-FAM46B-PGK-puro This study N/A SB100X (Mates et al., 2009) Izsvák lab Software and algorithms FastQC (v0.11.9) http://www.bioinformatics. babraham.ac.uk/projects https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ MultiQC (v1.9) (Ewels et al., 2016) https://multiqc.info/ TrimGalore (v0.6.5) http://www.bioinformatics. babraham.ac.uk/projects http://www.bioinformatics. babraham.ac.uk/projects/ trim_galore/ STAR (v2.7.4a) (Dobin et al., 2013) https://github.com/alexdobin/ STAR featureCounts (v2.0.0) (Liao et al., 2014) http://subread.sourceforge.net/ TEtranscripts (v2.2.1) (Jin et al., 2015) https://github.com/mhammell- laboratory/TEtranscripts Seurat (v4.0.5) (Hao et al., 2021) https://satijalab.org/seurat/ DESeq2 (v1.28.1) (Love et al., 2014) https://bioconductor.org/ packages/release/bioc/html/ DESeq2.html edgeR (v3.34.1) (Robinson et al., 2010) https://bioconductor.org/ packages/release/bioc/html/ edgeR.html Scater (v1.20.1) (McCarthy et al., 2017) https://bioconductor.org/ packages/release/bioc/ html/scater.html clusterProfiler (v3.16.1) (Yu et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ clusterProfiler.html ComplexHeatmap (v2.7.4) (Gu et al., 2016) https://github.com/jokergoo/ ComplexHeatmap FactoMineR (v2.4) N/A http://factominer.free.fr Sambamba (v0.8.2) (Tarasov et al., 2015) https://lomereiter.github.io/ sambamba/index.html bowtie2 (v2.4.5) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge. net/bowtie2/index.shtml deepTools (v3.5.1) (Ramirez et al., 2016) https://deeptools.readthe docs.io/en/develop/ sva (v3.40.0) (Leek et al., 2012) http://www.bioconductor.org/ packages/release/bioc/html/ sva.html (Continued on next page) e4 Cell Reports 39, 110994, June 21, 2022 Article ll OPEN ACCESS



    Similar Products

    hiscript iii  (Vazyme Biotech Co)
    99
    Vazyme Biotech Co hiscript iii
    Hiscript Iii, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/assays+hiscript+iii+1st+strand+cdna+synthesis+kit/HiScript+III+1st+Strand+cDNA+Synthesis+Kit+%2BgDNA+wiper/pmc13050104-105-7-9
    Average 99 stars, based on 1 article reviews
    hiscript iii - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    hiscript iii 1st strand cdna synthesis kit  (Vazyme Biotech Co)
    99
    Vazyme Biotech Co hiscript iii 1st strand cdna synthesis kit
    Hiscript Iii 1st Strand Cdna Synthesis Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/assays+hiscript+iii+1st+strand+cdna+synthesis+kit/HiScript+III+1st+Strand+cDNA+Synthesis+Kit+%2BgDNA+wiper/pmc13129441-63-8-15
    Average 99 stars, based on 1 article reviews
    hiscript iii 1st strand cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    r312  (Vazyme Biotech Co)
    99
    Vazyme Biotech Co r312
    R312, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/assays+hiscript+iii+1st+strand+cdna+synthesis+kit/HiScript+III+1st+Strand+cDNA+Synthesis+Kit+%2BgDNA+wiper/pmc13125189-135-19-20
    Average 99 stars, based on 1 article reviews
    r312 - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    hiscript ii 1st strand cdna synthesis kit  (Vazyme Biotech Co)
    99
    Vazyme Biotech Co hiscript ii 1st strand cdna synthesis kit
    Hiscript Ii 1st Strand Cdna Synthesis Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/assays+hiscript+iii+1st+strand+cdna+synthesis+kit/HiScript+III+All-in-one+RT+SuperMix+Perfect+for+qPCR/pmc13010958-103-14-22
    Average 99 stars, based on 1 article reviews
    hiscript ii 1st strand cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    hiscript iii 1st strand cdna synthesis kit +gdna wiper  (Vazyme Biotech Co)
    99
    Vazyme Biotech Co hiscript iii 1st strand cdna synthesis kit +gdna wiper
    Hiscript Iii 1st Strand Cdna Synthesis Kit +Gdna Wiper, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/assays+hiscript+iii+1st+strand+cdna+synthesis+kit/HiScript+III+1st+Strand+cDNA+Synthesis+Kit+%2BgDNA+wiper/custom%40r312%4041891923
    Average 99 stars, based on 1 article reviews
    hiscript iii 1st strand cdna synthesis kit +gdna wiper - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    hiscript iiist strand cdna synthesis kit  (Vazyme Biotech Co)
    99
    Vazyme Biotech Co hiscript iiist strand cdna synthesis kit
    Hiscript Iiist Strand Cdna Synthesis Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/assays+hiscript+iii+1st+strand+cdna+synthesis+kit/HiScript+III+1st+Strand+cDNA+Synthesis+Kit+%2BgDNA+wiper/pm42075407-130-7-17
    Average 99 stars, based on 1 article reviews
    hiscript iiist strand cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    hiscript iii first strand cdna synthesis kit  (Vazyme Biotech Co)
    99
    Vazyme Biotech Co hiscript iii first strand cdna synthesis kit
    Hiscript Iii First Strand Cdna Synthesis Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/assays+hiscript+iii+1st+strand+cdna+synthesis+kit/HiScript+III+1st+Strand+cDNA+Synthesis+Kit+%2BgDNA+wiper/pmc13023788-278-15-25
    Average 99 stars, based on 1 article reviews
    hiscript iii first strand cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results